Transcriptome Sequencing

Data Generation Protocols Data Analysis Protocols
BLBurkitt Lymphoma Data Generation Protocol Icon BLBurkitt Lymphoma Data Analysis Protocol Icon

Data Generation Protocols

The data generation protocols for the Burkitt Lymphoma (BL) project were acquired from the following manuscript.

Grande BM, Gerhard DS, Jiang A, et al. Genome-wide discovery of somatic coding and non-coding mutations in pediatric endemic and sporadic Burkitt lymphoma. Blood. March 2019; 21;133(12):1313-1324. (PMID: 30617194)

Strand-specific ribosomal RNA depletion RNA sequencing 

RNA sequencing (RNA-seq) libraries were constructed from RNA provided by Nationwide Children’s Hospital (Columbus, OH) using a strand-specific ribosomal depletion protocol. To remove cytoplasmic and mitochondrial ribosomal RNA (rRNA) species from total RNA NEBNext rRNA Depletion Kit for Human/Mouse/Rat was used (NEB, E6310X). Enzymatic reactions were set-up in a 96-well plate (Thermo Fisher Scientific) on a Microlab NIMBUS liquid handler (Hamilton Robotics, USA). 100ng of DNase I treated total RNA in 6 µL was hybridized to rRNA probes in a 7.5 µL reaction. Heat-sealed plates were incubated at 95°C for 2 minutes followed by incremental reduction in temperature by 0.1°C per second to 22°C (730 cycles). The rRNA in DNA hybrids were digested using RNase H in a 10 µL reaction incubated in a thermocycler at 37°C for 30 minutes. To remove excess rRNA probes (DNA) and residual genomic DNA contamination, DNase I was added in a total reaction volume of 25 µL and incubated at 37°C for 30 minutes. RNA was purified using RNA MagClean DX beads (Aline Biosciences, USA) with 15 minutes of binding time, 7 minutes clearing on a magnet followed by two 70% ethanol washes, 5 minutes to air dry the RNA pellet and elution in 36 uL DEPC water. The plate containing RNA was stored at -80°C prior to cDNA synthesis.

First-strand cDNA was synthesized from the purified RNA (minus rRNA) using the Maxima H Minus First Strand cDNA Synthesis kit (Thermo-Fisher, USA) and random hexamer primers at a concentration of 8ng/µL along with a final concentration of 0.4µg/µL Actinomycin D, followed by PCR Clean DX bead purification on a Microlab NIMBUS robot (Hamilton Robotics, USA). The second strand cDNA was synthesized following the NEBNext Ultra Directional Second Strand cDNA Synthesis protocol (NEB) that incorporates dUTP in the dNTP mix, allowing the second strand to be digested using USERTM enzyme (NEB) in the post-adapter ligation reaction and thus achieving strand specificity.

cDNA was fragmented by Covaris LE220 sonication for 130 seconds (2 x 65 seconds) at a “Duty cycle” of 30%, 450W Peak Incident Power and 200 Cycles per Burst in a 96-well microTUBE Plate (P/N: 520078) to achieve 200-250 bp average fragment lengths. The paired-end sequencing library was prepared following the BC Cancer Agency Genome Sciences Centre strand-specific, plate-based library construction protocol on a Microlab NIMBUS robot (Hamilton Robotics, USA). Briefly, the sheared cDNA was subject to end-repair and phosphorylation in a single reaction using an enzyme premix (NEB) containing T4 DNA polymerase, Klenow DNA Polymerase and T4 polynucleotide kinase, incubated at 20°C for 30 minutes. Repaired cDNA was purified in 96-well format using PCR Clean DX beads (Aline Biosciences, USA), and 3’ A-tailed (adenylation) using Klenow fragment (3’ to 5’ exo minus) and incubation at 37°C for 30 minutes prior to enzyme heat inactivation. Illumina PE adapters were ligated at 20°C for 15 minutes. The adapter-ligated products were purified using PCR Clean DX beads, then digested with USERTM enzyme (1 U/µL, NEB) at 37°C for 15 minutes followed immediately by 13 cycles of indexed PCR using Phusion DNA Polymerase (Thermo Fisher Scientific Inc. USA) and Illumina’s PE primer set. PCR parameters: 98°C for 1 minute followed by 13 cycles of 98°C 15 seconds, 65°C 30 seconds and 72°C 30 seconds, and then 72°C 5 minutes. The PCR products were purified and size-selected using a 1:1 PCR Clean DX beads-to-sample ratio (twice), and the eluted DNA quality was assessed with Caliper LabChip GX for DNA samples using the High Sensitivity Assay (PerkinElmer, Inc. USA) and quantified using a Quant-iT dsDNA High Sensitivity Assay Kit on a Qubit fluorometer (Invitrogen) prior to library pooling and size-corrected final molar concentration calculation for Illumina HiSeq2500 sequencing with paired-end 75 base reads.

miRNA Sequencing

miRNA sequencing (miRNA-seq) libraries were constructed from 1 μg total RNA provided by Nationwide Children’s Hospital (Columbus, OH) using a plate-based protocol developed at the British Columbia Cancer, Genome Sciences Centre (BCGSC). Negative controls were added at three stages: elution buffer was added to one well when the total RNA was loaded onto the plate, water to another well just before ligating the 3’ adapter, and PCR brew mix to a final well just before PCR amplification. A 3’ adapter was ligated using a truncated T4 RNA ligase2 (NEB 212 Canada, cat. M0242L) with an incubation at 22°C for 1 hour. This adapter is an adenylated, single-stranded DNA with the sequence 5’ /5rApp/ ATCTCGTATGCCGTCTTCTGCTTGT/3ddC/, which selectively ligates to miRNAs. An RNA 5’ adapter was then ligated, using T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 hour. The sequence of the single strand RNA adapter is 5’GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3’.

Upon completion of adapter ligation, 1st strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat.18064 014) and RT primer (5’-221 CAAGCAGAAGACGGCATACGAGAT-3’). First-strand cDNA provided the template for the final library PCR, into which we introduce index sequences to enable libraries to be identified from a sequenced pool that contains multiple libraries. Briefly, a PCR brew mix was made with the 3’ PCR primer (5’-CAAGCAGAAGACGGCATACGAGAT-3’), Phusion Hot Start HighFidelity DNA polymerase (NEB Canada, cat. F-540L), buffer, dNTPs and DMSO. The mix was distributed evenly into a new 96-well plate. A Microlab NIMBUS robot (Hamilton Robotics, USA) was used to transfer the PCR template (1st strand cDNA) and indexed 5’ PCR primers into the brew mix plate. Each indexed 5’ PCR primer, 5’AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3’,contains a unique six-nucleotide ‘index’ (shown here as N’s), and was added to each well of the 96-well PCR brew plate. PCR was performed at 98°C for 30 seconds, followed by 15 cycles of 98°C for 15 seconds, 62°C for 30 seconds and 72°C for 15 seconds, and finally a 5 minute incubation at 72°C. Library qualities were assessed across the whole plate using a Caliper LabChipGX DNA chip. PCR products were pooled and size selected to remove larger cDNA fragments and smaller adapter contaminants, using a 96-channel 235 automated size selection robot that was developed at the BCGSC. After size selection, each pool was ethanol precipitated, quality checked using an Agilent Bioanalyzer DNA1000 chip and quantified using a Qubit fluorometer (Invitrogen, cat. Q32854). Each pool was diluted to a target concentration for cluster generation and loaded into a single lane of an Illumina HiSeq2500 flow cell. Clusters were generated, and lanes were sequenced with a 31-bp main read for the insert and a 7-bp read for the index.

Experimental Protocols

To request more information or approval regarding the following protocols, please contact BC Cancer at labqa@bcgsc.ca.

96-well Plate-based Strand-specific cDNA Synthesis using Maxima H Minus on Hamilton NIMBUS

Nimbus-assisted 96-well PCR-enriched Library Construction for Illumina Sequencing

Plate-based rRNA depletion

miRNA3 – Plate Format miRNA Library Construction

Data Analysis Protocol

The data analysis protocols for the Burkitt Lymphoma (BL) project were acquired from the following manuscript.

Grande BM, Gerhard DS, Jiang A, et al. Genome-wide discovery of somatic coding and non-coding mutations in pediatric endemic and sporadic Burkitt lymphoma. Blood. March 2019; 21;133(12):1313-1324. (PMID: 30617194)

Gene expression quantification 

The tximport Bioconductor R package was used to summarize transcript-level read counts at the gene level. The DESeq2 Bioconductor R package was used to correct the read counts for library size and to perform a variance-stabilizing data transformation. These variance-stabilized expression values were used for statistical tests that require homoskedastic data.

miRNA expression profiling was performed separately on the miRNA sequencing data using Canada’s Michael Smith Genome Sciences Centre miRNA processing pipeline, which was used for The Cancer Genome Atlas project. The analysis was done using miRBase release 21.

Last updated: June 03, 2020